Hepatic CYP2B10 is highly induced by binge ethanol and contributes to acute-on-chronic alcohol-induced liver injury

Bryan Mackowiak; Mingjiang Xu; Yuhong Lin; Yukun Guan; Wonhyo Seo; Ruixue Ren; Dechun Feng; Jace W. Jones; Hongbing Wang; Bin Gao

doi:10.1111/acer.14954

Hepatic CYP2B10 is highly induced by binge ethanol and contributes to acute-on-chronic alcohol-induced liver injury

Bryan Mackowiak, Mingjiang Xu, Yuhong Lin, Yukun Guan, Wonhyo Seo, Ruixue Ren, Dechun Feng, Jace W. Jones, Hongbing Wang, Bin Gao

Research output: Contribution to journal › Article › peer-review

Abstract

Background: The chronic-plus-binge model of ethanol consumption, where chronically (8-week) ethanol-fed mice are gavaged a single dose of ethanol (E8G1), is known to induce steatohepatitis in mice. However, how chronically ethanol-fed mice respond to multiple binges of ethanol remains unknown. Methods: We extended the E8G1 model to three gavages of ethanol (E8G3) spaced 24 h apart, sacrificed each group 9 h after the final gavage, analyzed liver injury, and examined gene expression changes using microarray analyses in each group to identify mechanisms contributing to liver responses to binge ethanol. Results: Surprisingly, E8G3 treatment induced lower levels of liver injury, steatosis, inflammation, and fibrosis as compared to mice after E8G1 treatment. Microarray analyses identified several pathways that may contribute to the reduced liver injury after E8G3 treatment compared to E8G1 treatment. The gene encoding cytochrome P450 2B10 (Cyp2b10) was one of the top upregulated genes in the E8G1 group and was further upregulated in the E8G3 group, but only moderately induced after chronic ethanol consumption, as confirmed by RT-qPCR and western blot analyses. Genetic disruption of Cyp2b10 worsened liver injury in E8G1 and E8G3 mice with higher blood ethanol levels compared to wild-type control mice, while in vitro experiments revealed that CYP2b10 did not directly promote ethanol metabolism. Metabolomic analyses revealed significant differences in hepatic metabolites from E8G1-treated Cyp2b10 knockout and WT mice, and these metabolic alterations may contribute to the reduced liver injury in Cyp2b10 knockout mice. Conclusion: Hepatic Cyp2b10 expression is highly induced after ethanol binge, and such upregulation reduces acute-on-chronic ethanol-induced liver injury via the indirect modification of ethanol metabolism.

Original language	English
Pages (from-to)	2163-2176
Number of pages	14
Journal	Alcoholism: Clinical and Experimental Research
Volume	46
Issue number	12
DOIs	https://doi.org/10.1111/acer.14954
State	Published - Dec 2022

Keywords

Cyp2b
binge
cyp2b10
ethanol
liver

Access to Document

10.1111/acer.14954

Cite this

@article{966347113c4c4330a13d2e2448a3b358,

title = "Hepatic CYP2B10 is highly induced by binge ethanol and contributes to acute-on-chronic alcohol-induced liver injury",

abstract = "Background: The chronic-plus-binge model of ethanol consumption, where chronically (8-week) ethanol-fed mice are gavaged a single dose of ethanol (E8G1), is known to induce steatohepatitis in mice. However, how chronically ethanol-fed mice respond to multiple binges of ethanol remains unknown. Methods: We extended the E8G1 model to three gavages of ethanol (E8G3) spaced 24 h apart, sacrificed each group 9 h after the final gavage, analyzed liver injury, and examined gene expression changes using microarray analyses in each group to identify mechanisms contributing to liver responses to binge ethanol. Results: Surprisingly, E8G3 treatment induced lower levels of liver injury, steatosis, inflammation, and fibrosis as compared to mice after E8G1 treatment. Microarray analyses identified several pathways that may contribute to the reduced liver injury after E8G3 treatment compared to E8G1 treatment. The gene encoding cytochrome P450 2B10 (Cyp2b10) was one of the top upregulated genes in the E8G1 group and was further upregulated in the E8G3 group, but only moderately induced after chronic ethanol consumption, as confirmed by RT-qPCR and western blot analyses. Genetic disruption of Cyp2b10 worsened liver injury in E8G1 and E8G3 mice with higher blood ethanol levels compared to wild-type control mice, while in vitro experiments revealed that CYP2b10 did not directly promote ethanol metabolism. Metabolomic analyses revealed significant differences in hepatic metabolites from E8G1-treated Cyp2b10 knockout and WT mice, and these metabolic alterations may contribute to the reduced liver injury in Cyp2b10 knockout mice. Conclusion: Hepatic Cyp2b10 expression is highly induced after ethanol binge, and such upregulation reduces acute-on-chronic ethanol-induced liver injury via the indirect modification of ethanol metabolism.",

keywords = "Cyp2b, binge, cyp2b10, ethanol, liver",

author = "Bryan Mackowiak and Mingjiang Xu and Yuhong Lin and Yukun Guan and Wonhyo Seo and Ruixue Ren and Dechun Feng and Jones, {Jace W.} and Hongbing Wang and Bin Gao",

note = "Funding Information: This work was supported by the intramural program of NIAAA, NIH (BG) and grant R21 AA 028521AA028521 (HW). C57BL/6N mice were purchased from the National Cancer Institute. Cyp2b10 knockout (KO) mice were generated in the UC Davis Knockout Mouse Project (KOMP) Repository (Strain ID: Cyp2b10tm1a(KOMP)Wtsi) and were backcrossed to a C57BL/6N background for more than 10 generations. Cyp2b10 KO mice were genotyped using long range polymerase chain reaction (PCR) according to the KOMP-CSD standard protocol. The 5′ genotyping primers were as follows: 5′ Universal (LAR3)—CACAACGGGTTCTTCTGTTAGTCC; and 5′ Gene Specific (GF4)—CAACATGGAGAACTGGCCATTAGC for a 5119 base pair product. The 3′ genotyping primers were: 3′ Universal (RAF5)—CACACCTCCCCCTGAACCTGAAAC; and 3′ Gene Specific (GR3)—CAACCAACACGTTAGTTCATTAGTCAATTC for an 8881 base pair product. After confirmation of the genotype, the Cyp2b10 KO mice were homozygous bred. Adh1 KO mice were kindly provided by Dr. Duester (Burnham Institute; Deltour et al., 1999), and backcrossed to a C57BL/6N background for more than 10 generations. Adh1 KO mice were genotyped as described previously (Anvret et al., 2012). All mouse experiments described in the current paper were reviewed and approved by the National Institute on Alcohol Abuse and Alcoholism Animal Care and Use Committee. C57BL/6N mice were purchased from the National Cancer Institute. Cyp2b10 knockout (KO) mice were generated in the UC Davis Knockout Mouse Project (KOMP) Repository (Strain ID: Cyp2b10tm1a(KOMP)Wtsi) and were backcrossed to a C57BL/6N background for more than 10 generations. Cyp2b10 KO mice were genotyped using long range polymerase chain reaction (PCR) according to the KOMP-CSD standard protocol. The 5′ genotyping primers were as follows: 5′ Universal (LAR3)—CACAACGGGTTCTTCTGTTAGTCC; and 5′ Gene Specific (GF4)—CAACATGGAGAACTGGCCATTAGC for a 5119 base pair product. The 3′ genotyping primers were: 3′ Universal (RAF5)—CACACCTCCCCCTGAACCTGAAAC; and 3′ Gene Specific (GR3)—CAACCAACACGTTAGTTCATTAGTCAATTC for an 8881 base pair product. After confirmation of the genotype, the Cyp2b10 KO mice were homozygous bred. Adh1 KO mice were kindly provided by Dr. Duester (Burnham Institute; Deltour et al., 1999), and backcrossed to a C57BL/6N background for more than 10 generations. Adh1 KO mice were genotyped as described previously (Anvret et al., 2012). All mouse experiments described in the current paper were reviewed and approved by the National Institute on Alcohol Abuse and Alcoholism Animal Care and Use Committee. Eight to twelve-week-old male or female mice were subjected to several different EtOH feeding protocols as described previously (Bertola, Park, & Gao, 2013; Xu et al., 2015). (1) Pair-fed for 8 weeks (P8w): The mice were pair-fed an isocaloric control diet for 8 weeks, followed by gavage administration of isocaloric dextrin-maltose. (2) Chronic feeding for 8 weeks (E8w): The mice were initially fed a controlled Lieber-DeCarli diet ad libitum for 5 days (F1259SP, Bio-Serv) to acclimatize them to a liquid diet. Subsequently, the EtOH-fed groups were allowed free access for 8 weeks to an EtOH diet (F1258SP, Bio-Serv) containing 5% (vol/vol) EtOH. (3) Chronic (8 weeks)-plus-gavage feeding (E8G1): The mice were fed as described for chronic feeding and mice received a single dose of EtOH (5 g/kg body weight) via gavage in the early morning and were sacrificed 9 h later. (4) Chronic (8 weeks)-plus-three gavages (E8G3): Mice were fed an EtOH diet for 8 weeks as described above and gavaged once per 24 h (5 g/kg EtOH) for 3 days. Mice were euthanized 9 h post the third gavage. (5) Acute gavage: The mice received a single dose of EtOH (5 g/kg body weight) via gavage in the early morning and were sacrificed 3, 6, 9, 24, or 72 h later. Mice were deeply anesthetized before blood collection from the orbital sinus into EDTA-coated tubes (Sardset) on ice or microcentrifuge tubes at room temperature for serum collection and euthanized via cervical dislocation. The liver, stomach, and intestines were harvested, quickly weighed (if applicable), and either snap frozen in liquid nitrogen or put in 10% formalin before further analysis. Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were analyzed by a Catalyst Dx Chemistry Analyzer (IDEXX Laboratories, Inc.). Serum triglyceride and cholesterol levels were measured using colorimetric/fluorometric assay kit (Cayman Chemical Company), according to the assay protocol. Hydroxyproline was measured using a commercial kit from BioVision following the manufacturer's instructions. Tissue specimens were fixed in 10% buffered formalin and embedded in paraffin. Then, 4-μm sections were used for staining (hematoxylin and eosin [H&E] or Sirius red dyes [MilliporeSigma]) and immunohistochemistry. Immunohistochemical staining for myeloperoxidase (MPO), α-smooth muscle actin (α-SMA), and CYP2B10 was performed using a prediluted rabbit anti-MPO polyclonal antibody (Biocare Medical, LLC), a monoclonal mouse anti-α-SMA (A2547; Sigma), and a rabbit anti-CYP2B10 antibody (EMD Millipore), respectively. Then, Vectastain rabbit/mouse avidin/biotin complex staining kit (Vector Laboratories, Inc.) was used according to the manufacturers' instructions for visualization. Liver samples from P8w, E8w, E8G1, and E8G3 were subjected to microarray analysis at the same time. Dye-coupled cDNAs were purified with a MiniElute PCR purification kit (Qiagen) and hybridized to an Agilent 44 K mouse 60-mer oligo microarray (Agilent Technologies). The data were processed and normalized using the Genespring GX software package (Agilent Technologies). The P8w, E8w, E8G1 microarray data were previously published and deposited in NCBI's Gene Expression Omnibus (No. GSE67546; Xu et al., 2015). The E8G3 microarray data are deposed in NCBI's Gene Expression Omnibus (GSE212755). Differential expression analysis was performed via the R package DESeq2 (v1.30.1). Genes with fold change >1.5 and padj <0.05 were put into gene set enrichment analysis via the R package clusterProfiler (v3.18.1). The R package pheatmap (v1.0.12) was used to create the heatmap plots. Interactive Venn diagrams and gene function analyses were processed by Ingenuity Pathway Analysis (IPA). The human ALD RNA-Seq data were obtained from Kim et al. (2021) analyses of Argemi et al. (2019). Total cellular RNA was isolated from the liver using a RNeasy mini kit (QIAGEN Inc.). One microgram of total RNA was reverse-transcribed by random priming and incubation with 200 U of Moloney murine leukemia virus transcriptase at 37°C for 1 h. The resulting single-stranded cDNA was then subjected to real-time PCR analyses with 18 S as internal controls. The primer sequences used are shown in Table S1. Microsomes were prepared as described previously (Sahi et al., 2000) with some modifications. Mouse liver tissue samples were snap frozen on dry ice and stored at −80°C until processing with all further procedures completed at 4°C. Ice-cold homogenization buffer (50 mM Tris–HCl, pH 7.0, 150 mM KCl, 2 mM EDTA) was added to tissues and processed with a handheld tissue homogenizer before a 15 s sonication. Homogenates were spun at 9000 × g for 20 min. The supernatant was transferred to ultracentrifuge tubes and spun at 100,000 × g for 45 min. The supernatants were removed, and the microsomal pellet was resuspended in 0.25 M sucrose. Protein concentrations of the subcellular fractions were determined using the Pierce bicinchoninic acid (BCA) protein assay kit (ThermoFisher Scientific Inc.) To determine CYP2b activity, 10 μM pentoxyresorufin (Tocris), a selective CYP2b substrate (Lubet et al., 1985), was incubated with control or induced (TCPOBOP) microsomes with or without the selective CYP2b inhibitor 2-Phenyl-2-(1-piperidinyl) propane preincubation (PPP, Cayman Chemicals; Chun et al., 2000). Microsomes were preincubated at 10× concentration (0.5 mg/ml) with PPP (30 μM) in incubation buffer (100 mM phosphate buffer [pH 7.4], 2 mM MgCl2, 5 mM glucose-6-phosphate (G6P), 1 mM NADP, 0.5 U/ml glucose-6-phosphate dehydrogenase) for 30 min to inactivate CYP2b (Walsky & Obach, 2007). Microsomes from preincubations (10 μl) were spiked into substrate-containing incubation buffer with a final volume of 0.1 ml and a final microsomal concentration of 0.05 mg/ml. EtOH concentrations for microsome incubations ranged from 5 to 200 mM. Acetaldehyde levels were measured by using gas chromatography mass spectrometry as described previously (Ren et al., 2020) Western blotting was performed as described previously (Ki et al., 2010). Protein bands were visualized by SuperSignal{\texttrademark} West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific Inc). Antibodies for ADH1 and β-actin were purchased from Cell Signaling Technology; anti CYP2B10 and CYP2E1 were purchased from Millipore. GAPDH was purchased from Abcam. Materials. LC–MS grade acetonitrile, methanol, water, and formic acid were purchased from Fisher Scientific. All chemicals and reagents were used without further purification. Metabolite extraction. Metabolites were extracted from plasma and liver tissues as follows. For plasma samples, 25 μl of plasma was combined with 500 μl of cold acetonitrile. For the tissue samples, 10 mg of tissue was homogenized in 200 μl of cold methanol with 5 mM PBS. An additional 400 μl of cold acetonitrile was added to the tissue homogenate. The mixtures were thoroughly vortex mixed for 1 min and stored at −80°C for 4 h. The samples were then centrifuged at 9300 g for 10 min at 4°C. Five hundred microlitre of supernatant was transferred and dried under a steady stream of nitrogen at 30°C. The dried sample was resuspended in water/acetonitrile (1:1, v/v) with 0.1% formic acid and stored at −20°C until analysis. The protein pellet following the centrifugation step was used to determine the protein content via a BCA kit (BCA assay, Thermo Fisher Scientific). Metabolite analysis. The metabolite extracts were analyzed by liquid chromatography high-resolution mass spectrometry (LC HRMS). The LC HRMS analyses were performed on an Agilent 1290 Infinity LC coupled to an Agilent 6560 Quadrupole Time-of-Flight (Q-TOF) mass spectrometer (Agilent Inc.). The separation was achieved using a Waters BEH Amide (1.7 μm; 2.1 × 150 mm) column (Waters Corp.). Mobile phase A was acetonitrile with 0.1% formic acid and mobile phase B was water with 0.1% formic acid. The gradient was held at 1% B for 0.1 min, ramped to 70% B in 6.9 min, ramped to 1% B in 0.1 min, and held at 1% B for 2.9 min. The flow rate was 0.4 ml/min. The column was maintained at 45°C and the auto-sampler was kept at 5°C. A 2 μl injection was used for both positive and negative ion mode. The MS parameters were as follows: extended dynamic range, 2 GHz; gas temperature, 300°C; gas flow, 10 L/min; nebulizer, 50 psi; sheath gas temperature, 350°C; sheath gas flow, 12 L/min; VCap, 3.5 kV (+), 3.0 kV (−); nozzle voltage, 250 V; reference mass m/z 121.0509, m/z 1221.9906 (+), m/z 119.0363, m/z 980.0164 (−); range m/z 100 to 1000; acquisition rate, three spectra/s. Data were acquired with MassHunter version B.09.00 (Agilent Inc.). LC HRMS data were analyzed with Profinder v10.0 (Agilent Inc.) and MetaboAnalyst 5.0 (Pang et al., 2021). Raw data files were directly imported into Profinder where retention time alignment, peak picking, deconvolution of adducts, peak integration, and determination of abundance were performed. Preliminary identification involved accurate mass correlation at a threshold of 10 ppm to the human metabolome database (HMDB; Wishart et al., 2022). The processed data generated from Profinder which included peak area and m/z value were exported into MetaboAnalyst for statistical analyses. Raw data has been uploaded to Mendeley Data (LCMS dataset_Hepatic CYP2B10 is highly induced by binge EtOH; DOI:10.17632/y2jxf74jyv.1). Data are presented as the mean ± SEM. Statistical analysis was performed with GraphPad Prism software (v. 9.0; GraphPad Software). Significance of data with multiple groups was evaluated via two-sided one-way or two-way ANOVA with Tukey's post hoc test dependent upon whether there were two types of variables (i.e. treatment group and mouse genotype) or a single variable (i.e. different treatment groups). Comparisons were considered statistically significant at p values of <0.05. Funding Information: This work was supported by the intramural program of NIAAA, NIH (BG) and grant R21 AA 028521AA028521 (HW). Publisher Copyright: {\textcopyright} 2022 Research Society on Alcoholism. This article has been contributed to by U.S. Government employees and their work is in the public domain in the USA.",

year = "2022",

month = dec,

doi = "10.1111/acer.14954",

language = "English",

volume = "46",

pages = "2163--2176",

journal = "Alcoholism: Clinical and Experimental Research",

issn = "0145-6008",

publisher = "Wiley-Blackwell",

number = "12",

}

TY - JOUR

T1 - Hepatic CYP2B10 is highly induced by binge ethanol and contributes to acute-on-chronic alcohol-induced liver injury

AU - Mackowiak, Bryan

AU - Xu, Mingjiang

AU - Lin, Yuhong

AU - Guan, Yukun

AU - Seo, Wonhyo

AU - Ren, Ruixue

AU - Feng, Dechun

AU - Jones, Jace W.

AU - Wang, Hongbing

AU - Gao, Bin

N1 - Funding Information: This work was supported by the intramural program of NIAAA, NIH (BG) and grant R21 AA 028521AA028521 (HW). C57BL/6N mice were purchased from the National Cancer Institute. Cyp2b10 knockout (KO) mice were generated in the UC Davis Knockout Mouse Project (KOMP) Repository (Strain ID: Cyp2b10tm1a(KOMP)Wtsi) and were backcrossed to a C57BL/6N background for more than 10 generations. Cyp2b10 KO mice were genotyped using long range polymerase chain reaction (PCR) according to the KOMP-CSD standard protocol. The 5′ genotyping primers were as follows: 5′ Universal (LAR3)—CACAACGGGTTCTTCTGTTAGTCC; and 5′ Gene Specific (GF4)—CAACATGGAGAACTGGCCATTAGC for a 5119 base pair product. The 3′ genotyping primers were: 3′ Universal (RAF5)—CACACCTCCCCCTGAACCTGAAAC; and 3′ Gene Specific (GR3)—CAACCAACACGTTAGTTCATTAGTCAATTC for an 8881 base pair product. After confirmation of the genotype, the Cyp2b10 KO mice were homozygous bred. Adh1 KO mice were kindly provided by Dr. Duester (Burnham Institute; Deltour et al., 1999), and backcrossed to a C57BL/6N background for more than 10 generations. Adh1 KO mice were genotyped as described previously (Anvret et al., 2012). All mouse experiments described in the current paper were reviewed and approved by the National Institute on Alcohol Abuse and Alcoholism Animal Care and Use Committee. C57BL/6N mice were purchased from the National Cancer Institute. Cyp2b10 knockout (KO) mice were generated in the UC Davis Knockout Mouse Project (KOMP) Repository (Strain ID: Cyp2b10tm1a(KOMP)Wtsi) and were backcrossed to a C57BL/6N background for more than 10 generations. Cyp2b10 KO mice were genotyped using long range polymerase chain reaction (PCR) according to the KOMP-CSD standard protocol. The 5′ genotyping primers were as follows: 5′ Universal (LAR3)—CACAACGGGTTCTTCTGTTAGTCC; and 5′ Gene Specific (GF4)—CAACATGGAGAACTGGCCATTAGC for a 5119 base pair product. The 3′ genotyping primers were: 3′ Universal (RAF5)—CACACCTCCCCCTGAACCTGAAAC; and 3′ Gene Specific (GR3)—CAACCAACACGTTAGTTCATTAGTCAATTC for an 8881 base pair product. After confirmation of the genotype, the Cyp2b10 KO mice were homozygous bred. Adh1 KO mice were kindly provided by Dr. Duester (Burnham Institute; Deltour et al., 1999), and backcrossed to a C57BL/6N background for more than 10 generations. Adh1 KO mice were genotyped as described previously (Anvret et al., 2012). All mouse experiments described in the current paper were reviewed and approved by the National Institute on Alcohol Abuse and Alcoholism Animal Care and Use Committee. Eight to twelve-week-old male or female mice were subjected to several different EtOH feeding protocols as described previously (Bertola, Park, & Gao, 2013; Xu et al., 2015). (1) Pair-fed for 8 weeks (P8w): The mice were pair-fed an isocaloric control diet for 8 weeks, followed by gavage administration of isocaloric dextrin-maltose. (2) Chronic feeding for 8 weeks (E8w): The mice were initially fed a controlled Lieber-DeCarli diet ad libitum for 5 days (F1259SP, Bio-Serv) to acclimatize them to a liquid diet. Subsequently, the EtOH-fed groups were allowed free access for 8 weeks to an EtOH diet (F1258SP, Bio-Serv) containing 5% (vol/vol) EtOH. (3) Chronic (8 weeks)-plus-gavage feeding (E8G1): The mice were fed as described for chronic feeding and mice received a single dose of EtOH (5 g/kg body weight) via gavage in the early morning and were sacrificed 9 h later. (4) Chronic (8 weeks)-plus-three gavages (E8G3): Mice were fed an EtOH diet for 8 weeks as described above and gavaged once per 24 h (5 g/kg EtOH) for 3 days. Mice were euthanized 9 h post the third gavage. (5) Acute gavage: The mice received a single dose of EtOH (5 g/kg body weight) via gavage in the early morning and were sacrificed 3, 6, 9, 24, or 72 h later. Mice were deeply anesthetized before blood collection from the orbital sinus into EDTA-coated tubes (Sardset) on ice or microcentrifuge tubes at room temperature for serum collection and euthanized via cervical dislocation. The liver, stomach, and intestines were harvested, quickly weighed (if applicable), and either snap frozen in liquid nitrogen or put in 10% formalin before further analysis. Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were analyzed by a Catalyst Dx Chemistry Analyzer (IDEXX Laboratories, Inc.). Serum triglyceride and cholesterol levels were measured using colorimetric/fluorometric assay kit (Cayman Chemical Company), according to the assay protocol. Hydroxyproline was measured using a commercial kit from BioVision following the manufacturer's instructions. Tissue specimens were fixed in 10% buffered formalin and embedded in paraffin. Then, 4-μm sections were used for staining (hematoxylin and eosin [H&E] or Sirius red dyes [MilliporeSigma]) and immunohistochemistry. Immunohistochemical staining for myeloperoxidase (MPO), α-smooth muscle actin (α-SMA), and CYP2B10 was performed using a prediluted rabbit anti-MPO polyclonal antibody (Biocare Medical, LLC), a monoclonal mouse anti-α-SMA (A2547; Sigma), and a rabbit anti-CYP2B10 antibody (EMD Millipore), respectively. Then, Vectastain rabbit/mouse avidin/biotin complex staining kit (Vector Laboratories, Inc.) was used according to the manufacturers' instructions for visualization. Liver samples from P8w, E8w, E8G1, and E8G3 were subjected to microarray analysis at the same time. Dye-coupled cDNAs were purified with a MiniElute PCR purification kit (Qiagen) and hybridized to an Agilent 44 K mouse 60-mer oligo microarray (Agilent Technologies). The data were processed and normalized using the Genespring GX software package (Agilent Technologies). The P8w, E8w, E8G1 microarray data were previously published and deposited in NCBI's Gene Expression Omnibus (No. GSE67546; Xu et al., 2015). The E8G3 microarray data are deposed in NCBI's Gene Expression Omnibus (GSE212755). Differential expression analysis was performed via the R package DESeq2 (v1.30.1). Genes with fold change >1.5 and padj <0.05 were put into gene set enrichment analysis via the R package clusterProfiler (v3.18.1). The R package pheatmap (v1.0.12) was used to create the heatmap plots. Interactive Venn diagrams and gene function analyses were processed by Ingenuity Pathway Analysis (IPA). The human ALD RNA-Seq data were obtained from Kim et al. (2021) analyses of Argemi et al. (2019). Total cellular RNA was isolated from the liver using a RNeasy mini kit (QIAGEN Inc.). One microgram of total RNA was reverse-transcribed by random priming and incubation with 200 U of Moloney murine leukemia virus transcriptase at 37°C for 1 h. The resulting single-stranded cDNA was then subjected to real-time PCR analyses with 18 S as internal controls. The primer sequences used are shown in Table S1. Microsomes were prepared as described previously (Sahi et al., 2000) with some modifications. Mouse liver tissue samples were snap frozen on dry ice and stored at −80°C until processing with all further procedures completed at 4°C. Ice-cold homogenization buffer (50 mM Tris–HCl, pH 7.0, 150 mM KCl, 2 mM EDTA) was added to tissues and processed with a handheld tissue homogenizer before a 15 s sonication. Homogenates were spun at 9000 × g for 20 min. The supernatant was transferred to ultracentrifuge tubes and spun at 100,000 × g for 45 min. The supernatants were removed, and the microsomal pellet was resuspended in 0.25 M sucrose. Protein concentrations of the subcellular fractions were determined using the Pierce bicinchoninic acid (BCA) protein assay kit (ThermoFisher Scientific Inc.) To determine CYP2b activity, 10 μM pentoxyresorufin (Tocris), a selective CYP2b substrate (Lubet et al., 1985), was incubated with control or induced (TCPOBOP) microsomes with or without the selective CYP2b inhibitor 2-Phenyl-2-(1-piperidinyl) propane preincubation (PPP, Cayman Chemicals; Chun et al., 2000). Microsomes were preincubated at 10× concentration (0.5 mg/ml) with PPP (30 μM) in incubation buffer (100 mM phosphate buffer [pH 7.4], 2 mM MgCl2, 5 mM glucose-6-phosphate (G6P), 1 mM NADP, 0.5 U/ml glucose-6-phosphate dehydrogenase) for 30 min to inactivate CYP2b (Walsky & Obach, 2007). Microsomes from preincubations (10 μl) were spiked into substrate-containing incubation buffer with a final volume of 0.1 ml and a final microsomal concentration of 0.05 mg/ml. EtOH concentrations for microsome incubations ranged from 5 to 200 mM. Acetaldehyde levels were measured by using gas chromatography mass spectrometry as described previously (Ren et al., 2020) Western blotting was performed as described previously (Ki et al., 2010). Protein bands were visualized by SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific Inc). Antibodies for ADH1 and β-actin were purchased from Cell Signaling Technology; anti CYP2B10 and CYP2E1 were purchased from Millipore. GAPDH was purchased from Abcam. Materials. LC–MS grade acetonitrile, methanol, water, and formic acid were purchased from Fisher Scientific. All chemicals and reagents were used without further purification. Metabolite extraction. Metabolites were extracted from plasma and liver tissues as follows. For plasma samples, 25 μl of plasma was combined with 500 μl of cold acetonitrile. For the tissue samples, 10 mg of tissue was homogenized in 200 μl of cold methanol with 5 mM PBS. An additional 400 μl of cold acetonitrile was added to the tissue homogenate. The mixtures were thoroughly vortex mixed for 1 min and stored at −80°C for 4 h. The samples were then centrifuged at 9300 g for 10 min at 4°C. Five hundred microlitre of supernatant was transferred and dried under a steady stream of nitrogen at 30°C. The dried sample was resuspended in water/acetonitrile (1:1, v/v) with 0.1% formic acid and stored at −20°C until analysis. The protein pellet following the centrifugation step was used to determine the protein content via a BCA kit (BCA assay, Thermo Fisher Scientific). Metabolite analysis. The metabolite extracts were analyzed by liquid chromatography high-resolution mass spectrometry (LC HRMS). The LC HRMS analyses were performed on an Agilent 1290 Infinity LC coupled to an Agilent 6560 Quadrupole Time-of-Flight (Q-TOF) mass spectrometer (Agilent Inc.). The separation was achieved using a Waters BEH Amide (1.7 μm; 2.1 × 150 mm) column (Waters Corp.). Mobile phase A was acetonitrile with 0.1% formic acid and mobile phase B was water with 0.1% formic acid. The gradient was held at 1% B for 0.1 min, ramped to 70% B in 6.9 min, ramped to 1% B in 0.1 min, and held at 1% B for 2.9 min. The flow rate was 0.4 ml/min. The column was maintained at 45°C and the auto-sampler was kept at 5°C. A 2 μl injection was used for both positive and negative ion mode. The MS parameters were as follows: extended dynamic range, 2 GHz; gas temperature, 300°C; gas flow, 10 L/min; nebulizer, 50 psi; sheath gas temperature, 350°C; sheath gas flow, 12 L/min; VCap, 3.5 kV (+), 3.0 kV (−); nozzle voltage, 250 V; reference mass m/z 121.0509, m/z 1221.9906 (+), m/z 119.0363, m/z 980.0164 (−); range m/z 100 to 1000; acquisition rate, three spectra/s. Data were acquired with MassHunter version B.09.00 (Agilent Inc.). LC HRMS data were analyzed with Profinder v10.0 (Agilent Inc.) and MetaboAnalyst 5.0 (Pang et al., 2021). Raw data files were directly imported into Profinder where retention time alignment, peak picking, deconvolution of adducts, peak integration, and determination of abundance were performed. Preliminary identification involved accurate mass correlation at a threshold of 10 ppm to the human metabolome database (HMDB; Wishart et al., 2022). The processed data generated from Profinder which included peak area and m/z value were exported into MetaboAnalyst for statistical analyses. Raw data has been uploaded to Mendeley Data (LCMS dataset_Hepatic CYP2B10 is highly induced by binge EtOH; DOI:10.17632/y2jxf74jyv.1). Data are presented as the mean ± SEM. Statistical analysis was performed with GraphPad Prism software (v. 9.0; GraphPad Software). Significance of data with multiple groups was evaluated via two-sided one-way or two-way ANOVA with Tukey's post hoc test dependent upon whether there were two types of variables (i.e. treatment group and mouse genotype) or a single variable (i.e. different treatment groups). Comparisons were considered statistically significant at p values of <0.05. Funding Information: This work was supported by the intramural program of NIAAA, NIH (BG) and grant R21 AA 028521AA028521 (HW). Publisher Copyright: © 2022 Research Society on Alcoholism. This article has been contributed to by U.S. Government employees and their work is in the public domain in the USA.

PY - 2022/12

Y1 - 2022/12

N2 - Background: The chronic-plus-binge model of ethanol consumption, where chronically (8-week) ethanol-fed mice are gavaged a single dose of ethanol (E8G1), is known to induce steatohepatitis in mice. However, how chronically ethanol-fed mice respond to multiple binges of ethanol remains unknown. Methods: We extended the E8G1 model to three gavages of ethanol (E8G3) spaced 24 h apart, sacrificed each group 9 h after the final gavage, analyzed liver injury, and examined gene expression changes using microarray analyses in each group to identify mechanisms contributing to liver responses to binge ethanol. Results: Surprisingly, E8G3 treatment induced lower levels of liver injury, steatosis, inflammation, and fibrosis as compared to mice after E8G1 treatment. Microarray analyses identified several pathways that may contribute to the reduced liver injury after E8G3 treatment compared to E8G1 treatment. The gene encoding cytochrome P450 2B10 (Cyp2b10) was one of the top upregulated genes in the E8G1 group and was further upregulated in the E8G3 group, but only moderately induced after chronic ethanol consumption, as confirmed by RT-qPCR and western blot analyses. Genetic disruption of Cyp2b10 worsened liver injury in E8G1 and E8G3 mice with higher blood ethanol levels compared to wild-type control mice, while in vitro experiments revealed that CYP2b10 did not directly promote ethanol metabolism. Metabolomic analyses revealed significant differences in hepatic metabolites from E8G1-treated Cyp2b10 knockout and WT mice, and these metabolic alterations may contribute to the reduced liver injury in Cyp2b10 knockout mice. Conclusion: Hepatic Cyp2b10 expression is highly induced after ethanol binge, and such upregulation reduces acute-on-chronic ethanol-induced liver injury via the indirect modification of ethanol metabolism.

AB - Background: The chronic-plus-binge model of ethanol consumption, where chronically (8-week) ethanol-fed mice are gavaged a single dose of ethanol (E8G1), is known to induce steatohepatitis in mice. However, how chronically ethanol-fed mice respond to multiple binges of ethanol remains unknown. Methods: We extended the E8G1 model to three gavages of ethanol (E8G3) spaced 24 h apart, sacrificed each group 9 h after the final gavage, analyzed liver injury, and examined gene expression changes using microarray analyses in each group to identify mechanisms contributing to liver responses to binge ethanol. Results: Surprisingly, E8G3 treatment induced lower levels of liver injury, steatosis, inflammation, and fibrosis as compared to mice after E8G1 treatment. Microarray analyses identified several pathways that may contribute to the reduced liver injury after E8G3 treatment compared to E8G1 treatment. The gene encoding cytochrome P450 2B10 (Cyp2b10) was one of the top upregulated genes in the E8G1 group and was further upregulated in the E8G3 group, but only moderately induced after chronic ethanol consumption, as confirmed by RT-qPCR and western blot analyses. Genetic disruption of Cyp2b10 worsened liver injury in E8G1 and E8G3 mice with higher blood ethanol levels compared to wild-type control mice, while in vitro experiments revealed that CYP2b10 did not directly promote ethanol metabolism. Metabolomic analyses revealed significant differences in hepatic metabolites from E8G1-treated Cyp2b10 knockout and WT mice, and these metabolic alterations may contribute to the reduced liver injury in Cyp2b10 knockout mice. Conclusion: Hepatic Cyp2b10 expression is highly induced after ethanol binge, and such upregulation reduces acute-on-chronic ethanol-induced liver injury via the indirect modification of ethanol metabolism.

KW - Cyp2b

KW - binge

KW - cyp2b10

KW - ethanol

KW - liver

UR - http://www.scopus.com/inward/record.url?scp=85140361485&partnerID=8YFLogxK

U2 - 10.1111/acer.14954

DO - 10.1111/acer.14954

M3 - Article

C2 - 36224745

AN - SCOPUS:85140361485

SN - 0145-6008

VL - 46

SP - 2163

EP - 2176

JO - Alcoholism: Clinical and Experimental Research

JF - Alcoholism: Clinical and Experimental Research

IS - 12

ER -

Hepatic CYP2B10 is highly induced by binge ethanol and contributes to acute-on-chronic alcohol-induced liver injury

Abstract

Keywords

Access to Document

Fingerprint

Cite this